Repeat Masking
Input
Input Sequences: Select the file that contains the DNA sequences to be masked. Input sequences must be in FASTA format.
Figure 1: Input Page
Search Configuration
Search Configuration: Select the search engine to perform the search for repeats.
RMBlast: This is a RepeatMasker compatible version of the NCBI Blast tool suite.
HMMER: It uses the nhmmer program to search sequences against the Dfam database.
Repeat Database: RepeatMasker works with these databases:
Dfam: It is a database of transposable elements included in the application, so it is not necessary to provide any additional file.
Custom: Allows providing a custom library of sequences to be masked in the query. The library file needs to contain repetitive elements in FASTA format. The recommended format for IDs in a custom library is ">repeatname#class/subclass".
RepBase: We highly recommend obtaining the RepeatMasker edition of RepBase. Searches are optimized to use this database and can produce higher-quality annotations. To obtain the RepBase RepeatMasker edition go to the Genetic Information Institute website. This option expects an EMBL file as a database file.
This functionality is compatible with the RepBase RepeatMasker edition 20181026 and 20170127. Make sure you are providing the proper database.
Database File: If it is necessary, select the file containing the database to perform the search.
Custom: The library file needs to contain sequences in FASTA format. The recommended format for IDs in a custom library is ">repeatname#class/subclass".
Repbase: EMBL file downloaded from the Genetic Information Institute website.
Species: Specify the species or clade of the input sequence. The species name must be a valid NCBI Taxonomy Database species name and be contained in the RepeatMasker repeat database. Take into account that if HMMER is selected as the search engine, the Dfam database only contains information about human, mouse, zebrafish, fruit fly, and nematode.
Figure 2: Configuration Page 1
RMBlast Options
Speed/Sensitivity: Select the sensitivity of the search. The more sensitive the longer the processing time:
Rush: About 10% less sensitive and 4-10 times faster than the default option (quick searches are fine under most circumstances).
Quick: 5-10% less sensitive, 2-5 times faster than the default.
Slow: 0-5% more sensitive, 2-3 times slower than the default.
Apply Divergence Cutoff: This option masks only those repeats that are less divergent from the consensus than a specific percentage.
Divergence Cutoff: Set the divergence cutoff.
Output Options
Masking Options: Select how sequences will be masked. Repetitive elements can be replaced by N, by X, or by lower case. Note that some downstream applications require a specific type of masking.
Only Alu elements: Only masks Alus and 7SLRNA, SVA, and LTR5. This option only works for primate DNA.
Type of repeat: Select the type of repeats that the algorithm will detect and mask: Interspersed repeats, simple repeats, and low complexity DNA, or both.
Not mask RNA genes: RepeatMasker by default screens for matches to small pol III transcribed RNAs (mostly tRNAs and snRNAs) due to their close similarity to SINEs and the abundance of some of their pseudogenes. Check this option if you are interested in leaving the small RNA genes sequences unmasked.
Figure 3: Configuration Page 2
Output
Output FASTA: Select a file where the masked sequences will be placed.
Figure 4: Output Page
Results
The Repeat Masking process returns the masked sequences in FASTA format and the location of the detected repeats in GFF format (Figure 5 and Figure 6). The repeat sequences found during the procedure are replaced by X, N, or lowercase (according to the selected mask option), so the output FASTA will contain the same sequences as the input FASTA but with the nucleotides corresponding to a repetitive element masked. The coordinates and strand, as well as the class and subclass of each repetitive element, are annotated in the output GFF project.
>LK927563.1 Caenorhabditis elegans genome assembly Ggaaagttctggaatgttccagaactttctagaaaaatcgagaaaattct ggaatgttccagaactttctagaacaattgggaaagttctggaatgttcc agaactttctagaaaaatcgagaaaattctggaatgttccagaactttct agaaaaaattggaaaattctggagaagcagaaaaattgagcttagagctt tagaagaggtagttatttgggagttgatgggggatcaagtcaaggtactg tagtggtactataggggtactgtaggtatacggtagggttactgtagttt tgggaaaaattggcattttgtcctttgaagagatattgggttaggagttg gtggaggataatgtcaaggtactgtagtggtattgtaaggttactgtctt ggccaaaaagtaacagaaagttttcatactgtctgtgaatttttgaaaca tgcatgtcgtagaaaaatacatacatgtaacagtgccagtaaaccgcgtt ttaagtgtttcaagtttttttcatgatgagaaattttttgagtgattgaa ggtatgtgtgtcaaatacttttaatggtgccagtcgttgcccgcgccgta ggcgcagtcagcggctggTATATATATAATTTTTTTCAGGGAGACTTCCA
Figure 5: Soft-masked Sequences (FASTA)
Figure 6: Output GFF
In addition to the resulting FASTA and GFF files, a report and a chart are generated. The report shows a summary of the Repeat Masking results (Figure 7). This page contains information about the input sequencing data and a results overview. The Results Overview table shows the number of elements, the length occupied, and the percentage of sequence that each repeat class and subclass covers.
Figure 7: Summary Report
The Repeat Distribution chart (Figure 8) shows the percentage of sequence covered by each repeat class.
Figure 8: Repeat Distribution Pie Chart